Table 2.

LiPA probes for the vacA andcagA gene

Gene and probeSequenceaPositionSpecificity
vacA s region
 P1S1aGGAGCRTTRGTCAGCATCAC61–80b s1a
 P22S1aGCTTTAGTAGGAGCRTTRGTC52–72b s1a
 P1S1b (S1b)GGAGCGTTGATTAGYKCCAT61–80b s1b
 P2S1bGTTTTAGCAGGAGCGTTGA52–72b s1b
 P1S2 (VAS2)GCTAAYACGCCAAAYGATCC88–107c s2
 P2S2GATCCCATACACAGCGAGAG103–122c s2
vacA m region
 P1M1TTGATACGGGTAATGGTGG1526–1544b m1
 P2M1GGGTAATGGTGGTTTCAACA1533–1552b m1
 P1M2ACGAATTTAAGAGTGAATGGC1522–1542c m2
 P2M2AGAGCGATAACGGGCTAAACA1577–1597c m2
cagA
 cagApro1GTTGATAACGCTGTCGCTTC94–113d cagA
 cagApro2TAATCTTCARGTRGCTTTTCTT68–89d cagA
  • a R is A or G, W is A or T, Y is C or T, and K is G or T.

  • b Nucleotide position numbers are according to the start codon of the vacA open reading frame in strain 60190 (GenBank accession no. U05676 ) for s1 and m1.

  • c Nucleotide position numbers are according to the start codon of the vacA open reading frame in strain Tx30a (GenBank accession no. U29401 ) for s2 and m2.

  • d For cagA the positions are according to the start codon of the cagA open reading frame in the sequence of the strain with GenBank accession no. L11714 .