Table 1.

Primers and probes used for PCR and hybridization assays

Oligonucleotide nameOligonucleotide sequence (5′→3′)Target organismTarget geneNucleotide positionProduct size (bp)Reference
p93ECCGCACAAGCGGTGGAGCAEubacteria16S rRNA931–949a 480 26
p13BAGGCCCGGGAACGTATTCACEubacteria16S rRNA1390–1371a
AF 1013FCTCGGAAACCGCAAGGACTG A. felis Ferredoxin41–60b 632 7
AF 1013RGATGTTGGGCCAAGTCTTAG A. felis Ferredoxin635–672b
Bhens probeTGCGAGCATTTGGTTGGGCA B. henselae 16S rRNA1050–1069c 1
Afelis probeTGCTACCATTTAGTTGAGCA A. felis 16S rRNA1073–1092d 1
  • a Positions within Escherichia coli 16S rRNA gene sequence (GenBank accession no. Eco 16s).

  • b Positions within A. felisferredoxin gene sequence (GenBank accession no. X81826).

  • c Positions within B. henselae 16S rRNA gene sequence (GenBank accession no. M73229).

  • d Positions within A. felis 16S rRNA gene sequence (GenBank accession no. M65248).