Table 1.

Features of the four polymorphic microsatellite sequences of A. fumigatus upon analysis of 100 isolates and 2 reference strains

MicrosatellitePrimer sequences (5′ to 3′)Microsatellite sequencesaLength range of PCR products (bp)Range of no. of repeatsTotal no. of alleles
AGCCTACGATGACCGAAATGA(CA)9(GA)25 108–15816–4112
CTGTTTTGAGAAGCGGATGG
BTTGCCATCGCTTGTCATAGA(CA)2C(CA)23 102–1349–2511
GCAGGTGGTTCAATAGGACAG
CCGAAGCTCTCCCCTGCAAATC(CA)8 165–1837–1610
GATGCCGCTGGTGGTGTTGT
DAGGGATACGGCTACGGACAA(CA)21 76–1347–3623
AAAGCGTCTGTCAGCGTGTCT
  • a Based on the original DNA sequences of strain IP 2279.94.