Table 1.

PCR primers for vacA and cagA used in this study

Gene and seg- mentPrimer designation (polarity)Primer sequence (5′→3′)aPositions
vacASVA1F (+)b Bio-ATGGAAATACAACAAACACAC1–21c
vacASVA1XR (−)Bio-CCTGARACCGTTCCTACAGC157–176c
184–203d
vacAMHPMGF (+)CACAGCCACTTTCAATAACGA1443–1463c
1419–1439d
vacAMHPMGR (−)CGTCAAAATAATTCCAAGGG1824–1843c
1875–1894d
vacAMMF1.1 (+)Bio-GTGGATGCCCATACGGCTAA1495–1514c
1470–1490d
vacAMMF1.2 (+)Bio-GTGGATGCTCATACAGCTWA1495–1514c
1470–1490d
vacAMMF1.3 (+)Bio-GTGGATGCCCATACGATCAA1495–1514c
1470–1490d
vacAMMF1.4 (+)Bio-GCGAGCGCTCATACGGTCAA1495–1514c
1470–1490d
vacAMMR1 (−)Bio-RTGAGCTTGTTGATATTGAC1582–1601c
1633–1652d
cagA cagAF (+)Bio-TTGACCAACAACCACAAACCG AAG17–40e
cagA cagAR (−)Bio-CTTCCCTTAATTGCGAGATTCC178–199e
  • a R = G or A, W = A or C, Bio = biotin at the 5′ end of the primer.

  • b The primer was from Atherton et al. (4).

  • c Positions corresponding to thevacA s1a-m1 open reading frame of H. pylori 60190 (GenBank accession no. U05676).

  • d Positions corresponding to thevacA s2-m2a open reading frame of H. pylori Tx30a (GenBank accession no. U29401).

  • e Positions corresponding to thecagA open reading frame of H. pyloriATCC 53726 (GenBank accession no. L11714).