Table 2.

Allele-specific probes for vacA and cagA used for reverse hybridization

Gene-segment and probe designationProbe sequence (5′→3′)aPositionsSpecificity
vacA-S
 P1S1GGAGCRTTRGTCAGCATCAC61–80b s1a
 P22S1aGCTTTAGTAGGAGCRTTRGTC52–72b s1a
 P1S1bGGAGCGTTGATTAGYKCCAT61–80b s1b
 P2S1bGTTTTAGCAGGAGCGTTGA52–72b s1b
 P3s1GGGYTATTGGTYAGCATCAC26–45b s1c
 P4s1GCTTTAGTRGGGYTATTGGT17–36b s1c
 P1S2GCTAAYACGCCAAAYGATCC88–107c s2
 P2S2GATCCCATACACAGCGAGAG103–122c s2
vacA-M
 P1M1TTGATACGGGTAATGGTGG1526–1544b m1
 P2M1GGGTAATGGTGGTTTCAACA1533–1552b m1
 P1M2aACGAATTTAAGAGTGAATGGC1522–1542c m2a
 P2M2aAGAGCGATAACGGGCTAAACA1577–1597c m2a
 P2M2bAGGGTAGAAATGGTATCGACA1577–1597d m2b
cagA
 cagApro1GTTGATAACGCTGTCGCTTC94–113e cagA
 cagApro2TAATCTTCARGTRGCTTTTCTT69–90e cagA
  • a R = G or A, Y = C or T, and K = G or T.

  • b Positions according to the vacAs1a-m1 open reading frame of H. pylori 60190 (GenBank accession no. U05676).

  • c Positions according to the vacAs2-m2 open reading frame of H. pylori Tx30a (GenBank accession no. U29401).

  • d No reference sequences of m1b are available, but the position numbers correspond to the positions in m2a sequences.

  • e Positions corresponding to thecagA open reading frame of H. pyloriATCC 53726 (GenBank accession no. L11714).