Table 1.

Oligonucleotides used for the siaspecific PCRs

Oligo- nucleotideSequence (5′-3′)TargetPositionaReference
SH39ATATCATTAGCATCTACC siaA 864–881b 9,10
UE16CGGACAACAGTTCTCCT siaC 2916–2900b 9,10
UE12CGCCTTTGCATCTGTCGTAGC siaC 2861–2881b 12
UE13GGAGATCAGAAGTCATAGTA siaD downstream region (serogroup B)4641–4622b 12
HC2AAATCTATAAATTGACTC siaC-siaD intergenic region (serogroup C)94–75 ntc upstream ofsiaDd 23
HC4GGAGATTTGTTTAGCT siaD downstream region (serogroup C)552–537 nt downstream of siaD Unpublished
B/CsiaD1AYATWTTGCATGTMSCYTTYCCTGA siaD (serogroups B and C)3702–3726b; 572–596d 6
B/CsiaD2AGACATTGGGTWGWRGGKGARAGTAA siaD (serogroups B and C)4161–4136b; 1031–1006d 6
HC39GTGTATGATATTCCAATC siaD (serogroup W135)1103–1124e 9
HC44GGTTATATATTTCTAGA siaD (serogroup Y)1079–1095f 9
HC50GGACAGTGGTGAGCTTTG siaD downstream region (serogroups W135 and Y)250–233 nt (W135) and 967–950 nt (Y) downstream of the siaD stop codonUnpublished
  • a Nucleotide positions are according to the numbering of the published sequences indicated in footnotesb, d, e, and f.

  • b EMBL accession no. M95053.

  • c nt, nucleotides.

  • d GenBank accession no. U75650.

  • e EMBL accession no. Y13970.

  • f EMBL accession no. Y13969.