Table 1.

16S rRNA gene primers used for PCR and sequencing

PrimerSequence (5′→3′)E. colipositiona
516FTGCCAGCAGCCGCGGTAA516–533
806FATTAGATACCCTGGTAGTCC787–806
806RGGACTACCAGGGTATCTAAT806–787
911RGCCCCCGTCAATTCMTTTGA930–911
1175FGAGGAAGGTGGGGATGACGT1175–1194
1175RACGTCATCCCCACCTTCCTC1194–1175
13RAGGCCCGGGAACGTATTCAC1390–1371
  • a E. coli position numbers are based on reference 5.