Table 1.

Unpublished PCR primers used in this study

GenePrimeraSequence 5′ to 3′Accession no.bPosition of primer
bla VEB-1 VEB-INV4FACGAAGAACAAATGCACAAGG AF010416 660–681
bla VEB-1 VEB-INV3BGAACAGAATCAGTTCCTCCG AF010416 610–591
bla OXA-10 OXA-10promBCGTTAATTCGACCTCAGAGGC AF205943 7491–7471
bla OXA-10 OXA-10casFTTAGGCCTCGCCGAAGCG AF205943 7331–7348
bla OXA-10 OXA-10casBCTTTGTTTTAGCCACCAATGATG AF205943 8297–8319
  • a F, forward nucleotide sequence; B, backward nucleotide sequence.

  • b Accession numbers are from the published sequences in the GenBank and EMBL databases.