Table 1.

Selected primers and probes for TaqMan amplification of viral RNA from influenza viruses A and B

Influenza virus type (target)Primer or probeSequenceNucleotide positionsa
A (M gene)INFA-15′ GGACTGCAGCGTAGACGCTT217–236  
INFA-25′ CATCCTGTTGTATATGAGGCCCAT382–405  
INFA-35′ CATTCTGTTGTATATGAGGCCCAT277–300  
INFA probe5′ CTCAGTTATTCTGCTGGTGCACTTGCCA349–376  
B (HA gene)INFB-15′ AAATACGGTGGATTAAATAAAAGCAA970–995  
INFB-25′ CCAGCAATAGCTCCGAAGAAA1119–1139
INFB probe5′ CACCCATATTGGGCAATTTCCTATGGC1024–1050
  • a Primer and probe positions for influenza virus A correspond to the matrix (M) gene of A/Port Chalmers/1/73 (H3N2) and A/Texas/36/91 (H1N1), and those for influenza virus B correspond to the hemagglutinin (HA) gene of B/Lee/40.