Table 2.

Primers used for Alu PCR

PCR primer or probe Sequences (5′ → 3′)Nucleotide position (reference)
Primers
 A3AGUGCCAAGUGUUUGCUGACGACUGCACUCCAGCCUGGGCGAC(23)
 A5CAGUGCCAAGUGUUUGCUGACGCCAAAGUGCUGGGAUUACAG (23)
 Tag3CAAGTGTTTGCTGACGACTGCA (7)
 Tag5CAAGTGTTTGCTGACGCCAAAG (23)
 EAV R10CCCUUCGUGUACGCCCACTGGAUGG (40a)
 EAV R11 CGTGGCACGTACCTAACACATGGGGAG(40b)
 EAV R13GAGCCTGACACGTTACATCCCGAGAC 61–86 (3c)
 EAV F14 AUAGGCGUGAUCGGGGUCUCGGGAUG(40d)
 EAV F15CGTGTCAGGCTCCTCCCCATGTGTTAGG 75–101 (3c)
 EAV F16GTGTCACCTCGGTATTTGGCCAAGCC 205–230 (3c)
 AMLV F1 CAGGUUUAGCAAGCUAGCUUAAGUAACG 58–85 (24e)
 AMLV F2CAGAACTGAGAATAGGGAAGTTCGGATCAAG 115–145 (24e)
 AMLV F3CAGGATATCTGTGGTAAGCAGTTTCG 181–206 (24e)
 AMLV R1CGAGCUGAUUGGUUAGUUCAAAUAAG 347–322 (24e)
 AMLV R2 CACAGGGTCACTTCAGGTCTTTG320–298 (24e)
 AMLV R3CATCTGATGGGTCCCTAGAAACTGCTG 283–257 (24e)
Probes
 EAV F13ATAGGCGTGATCGGGGTCTCGGGATG (40f)
 EAV F18 GCAGGCTCCCCTAAGCAACGAACATCACGGTTGCCTGCGAAAGGCAACAA231–280 (3c)
  • a Oligonucleotide 12 in reference40 with T's changed to U's.

  • b Oligonucleotide 11 in reference40.

  • c GenBank accession no. M31066.

  • d Oligonucleotide 6 in reference40 with T's changed to U's.

  • e GenBank accession no. M55597.

  • f Oligonucleotide 6 in reference40.