Table 1.

Pyrosequencing primers for the HIV-1 protease gene and the codons that each primer sequences

PrimerNucleotide sequence (5′–3′)Genomic locationaSequencing directionCodons sequencedbCodons involved in drug resistancec
1CCCTCARATCACTCTTTGGC2275–2294Forward 8–188, 10, 16
2TACTGTATYATCWGCYCCTGT2271–2251Reverse14–2520, 23, 24
3CTATTAGAYACAGGRGCWGA2342–2361Forward30–35 30
4TTTCCATYTYCCTGGYAAA2404–2386Reverse32–3632, 33, 36
5AAACCTCCAATTCCCCCTAT2433–2414Reverse37–4645,46
6d TTRCCAGGAARATGGAIRCCAAA2387–2409Forward46–57 46, 47, 48, 50, 52
7ATAGGGGGAATTGGAGGTTT2414–2433Forward54–6054, 55, 57, 60
8TTTATCAARGTAARACARTATGA2432–2454Forward61–6863
9CAATTATGTTGACAGGTGTAGGTCC2531–2507Reverse67–7769, 71, 73, 75, 77
10TGRGTCAACAIRTTTCTTCCA2550–2530Reverse75–8481,82, 84
11TACACCTRYCAACRTAATTGG2512–2532Forward87–9488,90, 91
12TTGGAAGAAAYITGWTGACYCA2529–2550Forward93–9997
  • a Genetic location (in nucleotides) refers to the MN sequence (accession no. AF075719).

  • b Codons 1 to 7, 26 to 29, 85, and 86 were not sequenced with this set of primers.

  • c The seven codons primarily involved in resistance are in boldface.

  • d The G variant of primer 6 was designed as pyrosequencing failed in a viral DNA sample because of an A-C mismatch at the underlined A.