Table 1.

Oligonucleotides used for DNA PCR and RT-PCR

PCR primer Sequence (5′ → 3′) Nucleotide positionFragment size (bp)
EAV F1GCTGTTCTTCATGTGCGAAG1624–1643a 352
EAV R1 CAGTGGACGCGGTATCAACAGTAA1975–1951a
EAV F2GTTCCGGGATTCTTTACAACTG 1654–1675a 276
EAV R2 CAGACGAGGCTCCAGCGTGAAGTC1929–1906a
ALV 21FTGTGTGGATTGACCAGTGG 2789–2807b 301
ALV 21R CGCAAGAGGAATAGAAAAGAAG3068–3089b
ALV P1CCTGTCTTTGTGATCCGG 2904–2921b 159
RSV R1 CTTGAGGTCTAAGACCATCAG3062–3042c
CRE F1GACTGGATGAGTACAAGTCTTC 2997–3018d 393
CRE R1 CAAGTCCAGGTAAATGACATC3389–3409d
CRE F2GTCAGGCGAGGTCCCAGATGAC 3109–3130d 268
CRE R2 CTCATCCACCAACGCCGTCAC3376–3356d
MNP1GGTTCGGATGGTTCGAGAACA 428–448e 477
MNP2 GGTTCATCAAGGACTCAAGTG 884–904e
MNP3 TGAAGTGCAAGACCCTGAGGG465–485e 400
MNP4TTCATGCAGTCCAAGAGCAGG 844–864e
  • a From reference 10.

  • b Based upon endogenous ALV sequences in CEF cells (37).

  • c GenBank accession no. J02342, J02021, andJ02343 (32).

  • d GenBank accession no. U88211(13).

  • e From reference 12.