Table 1.

Oligonucleotide primers selected for PCR

PrimerSequenceaTarget siteb
LP1GGGGGGTCCATTGCG 872→886
LP2TAGCAAGCTTAACCGA 595→610
LP3CTGCGGATGCACATTTATG 1151→1170
LP4AGAAGCTCGCGCCACG 1523→1508
23RNA11GGGACTTCAATCAAGAGCTTGCAC1869→1846
23RNA5GGTCAAGCGAACAAGTGC1→18
23RNA3AGGATCAAGCCTTACGGGC2865→2847
  • a Underlined nucleotides are putatively specific for B. gladioli.

  • b Numbering corresponds to the B. gladioli 23S rRNA nucleotide sequence (EMBL accession no. Y17182). The arrow indicates the direction of the oligonucleotide (5′ to 3′).