TABLE 2

Primer sequences used in this study

Primer namePrimer sequenceAmplicon size (bp)HRM temp range (°C)Purpose
Rifampin
    rpoB FACCGCAGACGTTGATCAACAT16686–90HRM
    rpoB RGGCACGCTCACGTGACAGAC
    rpoB SeqGGCGAGCTGATCCAAAACC261 Sequencing
    rpoB RGGCACGCTCACGTGACAGAC
Isoniazid
    inhA FCACGTTACGCTCGTGGACAT11983–88HRM and sequencing
    inhA RCAGGACTGAACGGGATACGAA
    katG FGGAAACTGTTGTCCCATTTCG10481–86HRM and sequencing
    katG RGGGCTGGAAGAGCTCGTATG