Table 1.

Oligonucleotide probes used for hybridization of some pathogens normally detected in blood from septic patients

ProbeaSequence (5′→3′)Target(s)Referenceb
EUBGCTGCCTCCCGTAGGAGTBacterial kingdom 2
Non-EUBACTCCTACGGGAGGCAGCNegative control 2
STREPGTTAGCCGTCCCTTTCTGG Streptococcusspp. 6
EFAECTTATCCCCCTCTGATGGG Enterococcus faecalis,Enterococcus sulfuricus
STAURAGAGAAGCAAGCTTCTCGTCCG Staphylococcus aureus 3
CoNS (RDR512)c CGACGGCTAGCTCCAAATGGTTACTCoNS 7
ECOLIGCAAAGGTATTAACTTTACTCCC Escherichia coli 9
PSEUDAERGGACGTTATCCCCCACTAT Pseudomonas aeruginosa
ENTBACCATGAATCACAAAGTGGTAAGCGCC Enterobacteriaceae 10
  • a All probes consist of single-stranded DNA covalently linked to fluorescein isothiocyanate at the 5′ end. All probes are directed against the 16S rRNA. Probe nomenclature consists of mnemonics instead of a formal nomenclature system for reasons of convenience.

  • b Previously published probes are referred to. Probes without a reference were designed by the authors of the present study.

  • c The original name given by Greisen and coworkers (7) is provided in parentheses.