Table 1.

Oligonucleotide probes used for FISH

ProbeTarget speciesProbe sequence (5′-3′)Target siteReference
EUB338BacteriaGCTGCCTCCCGTAGGAGT16S rRNA 1
PseaerA P. aeruginosa GGTAACCGTCCCCCTTGC16S rRNATrebesius et al., submitted
PseaerB P. aeruginosa TCTCGGCCTTGAAACCCC23S rRNATrebesius et al., submitted
Stemal S. maltophilia GTCGTCCAGTATCCACTGC16S rRNAPresent study
Burcep B. cepacia CTGTGCGCCGGTTCTCTT16S rRNAPresent study
Burkho Burkholderiaspp.ACCCTCTGTTCCGACCAT16S rRNAPresent study
Haeinf H. influenzae CCGCACTTTCATCTTCCG16S rRNAPresent study
Staaur S. aureus GAAGCAAGCTTCTCGTCCG16S rRNATrebesius et al., submitted
Caal C. albicans GCCAAGGCTTATACTCGCT18S rRNA 9
Strpyo Streptococcus pyogenes CTAACATGCGTTAGTCTCTC16S rRNATrebesius et al., submitted
BET42aBeta subclass ofProteobacteria GCCTTCCCACTTCGTTT16S rRNAa 10
  • a Unlabeled probe BET42a was added to hybridization buffer to reduce nonspecific binding of labeled oligonucleotide probes.