Table 1.

Nucleotide sequences, gene locations, and anticipated sizes of PCR products for the S. aureus gene-specific oligonucleotide primers used in this study

GeneaPrimerOligonucleotide sequence (5′-3′)Location within geneSize of amplified product (bp)Multiplex PCR set
sea GSEAR-1GGTTATCAATGTGCGGGTGG349–368102A
GSEAR-2CGGCACTTTTTTCTCTTCGG431–450
seb GSEBR-1GTATGGTGGTGTAACTGAGC666–685164A
GSEBR-2CCAAATAGTGACGAGTTAGG810–829
sec GSECR-1AGATGAAGTAGTTGATGTGTATGG432–455451A
GSECR-2CACACTTTTAGAATCAACCG863–882
sed GSEDR-1CCAATAATAGGAGAAAATAAAAG492–514278A
GSEDR-2ATTGGTATTTTTTTTCGTTC750–769
see GSEER-1AGGTTTTTTCACAGGTCATCC237–257209A
GSEER-2CTTTTTTTTCTTCGGTCAATC425–445
femA GFEMAR-1AAAAAAGCACATAACAAGCG1444–1463132A or B
GFEMAR-2GATAAAGAAGAAACCAGCAG1556–1575
mecA GMECAR-1ACTGCTATCCACCCTCAAAC1182–1201163B
GMECAR-2CTGGTGAAGTTGTAATCTGG1325–1344
eta GETAR-1GCAGGTGTTGATTTAGCATT775–79493B
GETAR-2AGATGTCCCTATTTTTGCTG848–867
etb GETBR-1ACAAGCAAAAGAATACAGCG509–528226B
GETBR-2GTTTTTGGCTGCTTCTCTTG715–734
tst GTSSTR-1ACCCCTGTTCCCTTATCATC88–107326B
GTSSTR-2TTTTCAGTATTTGTAACGCC394–113
  • a Nucleotide sequence and locations were derived from the published sequences for sea (5),seb (19), sec (7),sed (2), see (11),mecA (23), femA (4),eta (20), etb (16), andtst (6).