Table 2.

Primers used for PCR amplification or sequencing

PrimeraSequencebGeneNucleotide positionsc
EV2TCCGGCCCCTGAATGCGGCTAATCC5′ NTR446–470
EV1ACACGGACACCCAAAGTAGTCGGTCC5′ NTR559–533
006GGCAACTTCCACCACCACCVP21197–1179
011GCICCIGAYTGITGICCRAA2A3408–3389
012ATGTAYGTICCICCIGGIGGVP12951–2970
040ATGTAYRTICCIMCIGGIGCVP12951–2970
187ACIGCIGYIGARACIGGNCAVP12612–2631
188ACIGCIGTIGARACIGGNGVP12612–2630
189CARGCIGCIGARACIGGNGCVP12612–2631
222CICCIGGIGGIAYRWACATVP12969–2951
  • a EV1 and EV2 are from reference19, 006 is from reference 5, and 011, 012, and 040 are from reference 15.

  • b Sequences are shown 5′ to 3′, using standard IUB nucleotide ambiguity codes. I, deoxyinosine.

  • c Nucleotide sequence coordinates are given relative to the sequence of PV1-Mahoney (GenBank accession no. J02281).