Table 1.

Sequences of primers used in the PCR

GenePrimerSequence (5′-3′)
Carbamate kinase (arcC) arcC-UpTTGATTCACCAGCGCGTATTGTC
arcC-DnAGGTATCTGCTTCAATCAGCG
Shikimate dehydrogenase (aroE) aroE-UpATCGGAAATCCTATTTCACATTC
aroE-DnGGTGTTGTATTAATAACGATATC
Glycerol kinase (glpF) glpF-UpCTAGGAACTGCAATCTTAATCC
glpF-DnTGGTAAAATCGCATGTCCAATTC
Guanylate kinase (gmk) gmk-UpATCGTTTTATCGGGACCATC
gmk-DnTCATTAACTACAACGTAATCGTA
Phosphate acetyltransferase (pta) pta-UpGTTAAAATCGTATTACCTGAAGG
pta-DnGACCCTTTTGTTGAAAAGCTTAA
Triosephosphate isomerase (tpi) tpi-UpTCGTTCATTCTGAACGTCGTGAA
tpi-DnTTTGCACCTTCTAACAATTGTAC
Acetyl coenzyme A acetyltransferase (yqiL) yqiL-UpCAGCATACAGGACACCTATTGGC
yqiL-DnCGTTGAGGAATCGATACTGGAAC