Table 2.

Primer sequences for PCR and sequencing of 16S rRNA, 444Ep-ank and groESL heat shock operon genes of the E. phagocytophila genogroup

Gene and primer nameFunctionsNucleotide sequences of primers (5′–3′)Source or reference
16S rRNA
 EE1PCR, outer primer setTCCTGGCTCAGAACGAACGCTGGCGGC 4
 EE2AGTCACTGACCCAACCTTAAATGGCTG
 EE3PCR, inner primer setGTCGAACGGATTATTCTTTATAGCTTGC
 EE4CCCTTCCGTTAAGAAGGATCTAATCTCC
 EE5FPCR, sequencing, end part of 16S rRNA primer set (517 bp)ACCTTACCACTCCTTGACATGG 8)
 EE6RCACCCTAGTCACTGACCCAA
 EE7FSequencing, internal primersAATTATTGGGCGTAAAGGGCA
 EE8RTTAAGCCCTGGCATTTCACC
444 Ep-ank
 LA6PCR, sequencingGAGAGATGCTTATGGTAAGACCaturegli et al., submitted
 LA1CGTTCAGCCATCATTGTGAC
groESLheat shock operon
 EEgro1FPCRGAGTTCGACGGTAAGAAGTTCANewly designed primers
 EEgro2RCAGCGTCGTTCTTACTAGGAAC
 EEgro3FSequencing, internal primersGCGAATGGAGACAAGAACATA
 EEgro4RAGTTGCGTCTTTTGTGATTCG
 EEgro5FAGCGAAGTTGAGGTGAAGGA
 Eegro6RCGCTTCCTTAGCCTTGAGAA