Table 1.

Oligonucleotide primers and probes used in PCR and hybridization assays

Oligonucleotide primer or probeSequenceTarget organismTarget geneNucleotide positionReference or source
Borrelia-specific primers
 B-5SBor5′biotin-GAGTTCGCGGGAGAGTAGGTTATT B. burgdorferi sensu lato5S rRNA (rrfA)82–105This study
 23SBor       TCAGGGTACTTAGATGGTTCACTT B. burgdorferi sensu lato23S rRNA (rrlB)208–185This study
Probes
 SL5′amino-CTTTGACCATATTTTTATCTTCCA B. burgdorferi sensu lato23S-5S spacera 182–16724
 SS5′amino-AACACCAATATTTAAAAAACATAA B. burgdorferi sensu stricto23S-5S spacer59–3624
 GA5′amino-AACATGAACATCTAAAAACATAAA B. garinii 23S-5S spacer58–3524
 AF5′amino-AACATTTAAAAAATAAATTCAAGG B. afzelii 23S-5S spacer44–2124
 VS5′amino-CATTAAAAAAATATAAAAAATAAATTTAAGG B. valaisiana 23S-5S spacer51–2124
 Ruski5′amino-GAATAAAACATTCAAATAATATAAAC B. afzelii like23S-5S spacer67–42This study
Ehrlichia-specific primers
 16S8FE       GGAATTCAGAGTTGGATCMTGGYTCAG Eubacteria16S rRNA gene8–2727
 B-GA1B5′biotin-CGGGATCCCGAGTTTGCCGGGACTTCTTCT Ehrlichiagenus16S rRNA gene476–45627
Probes
 A-EhrAll5′amino-TTATCGCTATTAGATGAGCC Ehrlichiagenus16S rRNA gene203–22227
 A-HGE5′amino-GCTATAAAGAATAGTTAGTGG HGE agent16S rRNA gene87–10727
 A-Phago5′amino-TTGCTATAAAGAATAATTAGTGG E. phagocytophila 16S rRNA gene85–10727
 A-D-HGE5′amino-GCTATGAAGAATAGTTAGTG HGE agent variant16S rRNA gene87–10627
 A-D-Phago5′amino-TTGCTATGAAGAATAATTAGTG E. phagocytophila variant16S rRNA gene87–10627
 A-ESchot5′amino-GCTGTAGTTTACTATGGGTA Ehrlichialike16S rRNA gene76–9527
 A-ECan5′amino-TCTGGCTATAGGAAATTGTTA Ehrlichia canis 16S rRNA gene85–10527
 A-EChaf5′amino-ACCTTTTGGTTATAAATAATTGTTA E. chaffeensis 16S rRNA gene83–10727
 A-EmurisC5′amino-GCTATAGGTTCGCTATTAG E. muris C variant16S rRNA gene85–103This study
 A-EmurisT5′amino-AGCTATAGGTTTGCTATTAGT E. muris T variant16S rRNA gene86–104This study
Spike primers
 23SBortmpA CGGGATCCC-TCAGGGTACTTAGATGGTTCACTT-ACCCCGAACTTTTCTCC b T. pallidum tmpA 199–215This study
 5SBortmpA GGAATT-CGAGTTCGCGGGAGAGTAGGTTATT-CTTCCCCAGTTCTGTGTAGA T. pallidum tmpA 725–706This study
 EhrFtmpB GCTCTAGAG-AGAGTTTGATCCTGGCTCAG-CGCCTATCCGACCGAGTAT T. pallidum tmpB 308–326This study
 EhrRtmpB CGGGATCCC-GAGTTTGCCGGGACTTCTTCTA-CCACGTAGTCACCTTGTATT T. pallidum tmpB 756–736This study
Probes
 A-TmpABor5′amino-TACAATCTAAGATCCAGACT T. pallidum tmpA 346–365This study
 A-TmpBEhr5′amino-GAAAACTCGAAGAACAAAGAA T. pallidum tmpB 502–522This study
  • a The SL probe targets the spacer and the first eight bases of the 23S gene sequence (rrlB).

  • b The dashes in the spike primers indicate the separation between the restriction site sequences, theBorrelia or Ehrlichia sequence, and thetmpA- or tmpB-specific sequence.