Table 1.

Oligonucleotide primers used in this work

Primera5′→3′Sequenceb(5′→3′)UseSpecies
Asp-1 SenseATAGGATCCGTBGTBTTYCAYTGG Universal Aspergillus spp.
Asp-2 AntisenseCGCGGATCCAAYTTYTTYTGYTCCAT Universal Aspergillus spp.
P-A1 SenseCTTCTTTGCGTGCAGAGA Specific for cyp51A A. fumigatus
P-A2 Antisense GGGGTCGTCAATGGACTASpecific for cyp51A A. fumigatus
P-A3Sense TAGTCCATTGACGACCCC Specific for cyp51A A. fumigatus
P-B1 Sense CTTTTTCGACTGCCGCGCSpecific for cyp51B A. fumigatus
P-B2Antisense AGGCGTAGTGAGTGGAGA Specific for cyp51B A. fumigatus
P-B3 Sense TCTCCACTCACTACGCCTSpecific for cyp51B A. fumigatus
Asp-7 Antisense CCARCGRTGNGGRTCCCA Universal A. fumigatus
P-A5 AntisenseTCTCTGCACGCAAAGAAGAAC cyp51A 5′ end A. fumigatus
P-A6 Sense ACCCCTTACATGATTCCTCCCC cyp51A 3′ end A. fumigatus
P-A7Sense TCATATGTTGCTCAGCGG cyp51A 5′ end A. fumigatus
P-B5 AntisenseTTGCGCGGCAGTCGAAAAAGAAC cyp51B 5′ end A. fumigatus
P-B6 Sense CATGGCTGTGGATGGTACTTC cyp51B 3′ end A. fumigatus
P-B7Sense ACTAGGGTCAGTTAGTCC cyp51B 5′ end A. fumigatus
P-B9 AntisenseCCTCATAATATGCTAAGG cyp51B 3′ end A. fumigatus
T-7* Sense TAATACGACTCACTATAGGGCGA 5′ and 3′ ends and sequencing A. fumigatus
Sp-6* Sense ATTTAGGTGACACTATAGAATAC 5′ and 3′ ends and sequencing A. fumigatus
  • a Asterisks denote commercially available primers (Pharmacia).

  • b DNA letter code: B = C or G or T; Y = C or T; R = G or A; N = A or G or C or T. Underlining indicates a BamHI restriction site.