Table 5.

Immobilized primers for on-chip PCR amplification

OligonucleotideaAmino acid positionAmino acid substitutionbNucleotide substitutionSequence (5′→3)cSequence position
a1pcr513Gln (WT)CAA TTCGGCACCAGCCAGCCAGCTGAGCCA 2355–2378
b1pcr513Gln→LeuCAA→CTA TTCGGCACCAGCCAGCCAGCTGAGCCt 2355–2377
c1pcr513Gln→LysCAA→AAA TTCGGCACCAGCCAGCCAGCTGAGCa 2355–2376
d1pcr513Gln→ProCAA→CCA TTCGGCACCAGCCAGCCAGCTGAGCCc 2355–2377
a2pcr515Met (WT)ATG TCGGCACCAGCCAGCTGAGACAATTCATG 2356–2384
b2pcr515Met→IleATG→ATA TCGGCACCAGCCAGCTGAGACAATTCATa 2356–2384
a3pcr516Asp (WT)GAC GCACCAGCCAGCTGAGACAATTCATGGAC 2359–2387
b3pcr516Asp→TyrGAC→TAC GCACCAGCCAGCTGAGCCAATTCATGt 2359–2385
c3pcr516Asp→GlyGAC→GGC GCACCAGCCAGCTGAGACAATTCATGGg 2359–2386
d3pcr516Asp→ValGAC→GTC GCACCAGCCAGCTGAGACAATTCATGGt 2359–2386
e3pcr516Asp→GluGAC→GAG GCACCAGCCAGCTGAGACAATTCATGGAg 2359–2387
a4pcr522Ser (WT)TCG GCCAATTCATGGACCAGAACAACCCGCTGTC 2374–2404
b4pcr522Ser→LeuTCG→TTG GCCAATTCATGGACCAGAACAACCCGCTGTt 2374–2404
a5pcr524Leu (WT)TTG→TCC CATGGACCAGAACAACCCGCTGTCGAGTTG 2381–2410
b5pcr524Leu→SerTTG→TCC CATGGACCAGAACAACCCGCTGTCGAGTTc 2381–2420
a6pcr526His (WT)CAC CCAGAACTACCCGCTGTCGTGGTTGACCC 2387–2415
b6pcr526His→LeuCAC→CTC CCAGAACTACCCGCTGTCGTGGTTGACCCt 2387–2416
c6pcr526His→AspCAC→GAC CCAGAACTACCCGCTGTCGTGGTTGACCg 2387–2415
d6pcr526His→Gln2CAC→CAA CCAGAACTACCCGCTGTCGTGGTTGACCCAa 2387–2417
e6pcr526His→GlnCAC→CAG CCAGAACTACCCGCTGTCGTGGTTGACCCAg 2387–2417
f6pcr526His→CysCAC→TGC CCAGAACTACCCGCTGTCGTGGTTGACCTg 2387–2416
g6pcr526His→AsnCAC→AAC CCAGAACTACCCGCTGTCGTGGTTGACCa 2387–2415
h6pcr526His→ArgCAC→CGC CCAGAACTACCCGCTGTCGTGGTTGACCCg 2387–2416
i6pcr526His→ProCAC→CCC CCAGAACTACCCGCTGTCGTGGTTGACCCc 2387–2416
j6pcr526His→TyrCAC→TAC CCAGAACTACCCGCTGTCGTGGTTGACCt 2387–2415
a7pcr531Ser (WT)TCG GGTTGACCAACAAGCGCCGACTGTC 2407–2431
b7pcr531Ser→LeuTCG→TTG GGTTGACCAACAAGCGCCGACTGTt 2407–2431
c7pcr531Ser→TrpTCG→TGG GGTTGACCAACAAGCGCCGACTGTGg 2407–2431
d7pcr531Ser→GlnTCG→CAG GGTTGACCAACAAGCGCCGACTGca 2407–2431
e7pcr531Ser→CysTCG→TGT GGTTGACCAACAAGCGCCGACTGTGt 2407–2432
a8pcr533Leu (WT)CTG TGACCCACAAGCGCCGACTGTCGGAGCT 2413–2437
b8pcr533Leu→ProCTG→CCG TGACCCACAAGCGCCGACTGTCGGAGc 2413–2437
  • a The designations of oligonucleotides correspond to their locations in Fig. 3.

  • b WT, wild type.

  • c The sequences belong to the antisense strand. The variable 3′ nucleotides are shown in lowercase.