Table 2.

Primers used in genomovar determination of theB. cepacia complex

Primer nameSequenceaTarget siteb
G1c GCCATGGATACTCCAAAAGGA153–133 (23S)
G2c TCGGAATCCTGCTGAGAGGC939–958 (16S)
SPR3TCGAAAGAGAACCGGCG 969–985 (16S)
SPR4TCGAAAGAGAACCGATA 969–985 (16S)
PSLAGGATTAGATACCCTGGTAGTCCA780–803 (16S)
PSRACTTAACCCAACATCTCACGACAC1092–1068 (16S)
  • a Oligonucleotide sequence, 5′ to 3′. Underlined regions denote variable nucleotides.

  • b Numbers correspond to position in the sequence with GenBank accession numbers X16368 for primer G1; all other numbers correspond to position in the sequence with GenBank accession number X87275.

  • c Primer G1 is also called C-SSR, and primer G2 is also called C-SSF, as described by LiPuma et al. (14).