Table 1.

Sequences of primers used to amplify vanAgenes in PCR experimentsa

PrimerAmpliconPrimer sequence (5′→3′)Amplicon size of EF228 (kb)% of isolates with amplicon the same size as EF228
vanR1vanRSATGAGCGATAAAATACITT1.899.2
vanS2TTAGGACCTCCTTTTATC
vanS1vanSHTTGGTTATAAAATTGAAAATT2.320
vanH2CTATTCATGCTCCTGTCT
vanH1vanHAXATGAATAACATCGGCATTAC2.6100
vanX2TTATTTAACGGGGAAATC
vanX1vanXYATGGAAATAGGATTTACTTT1.9100
vanY2TTACCTCCTTGAATTAGTAT
vanY1vanYZATGAAGAAGTTGTTTTTTTTA1.699.2
vanZ2CTTACACGTAATTTATTC
  • a See references 3 and18.