Table 3.

VNTR marker attributes

Marker locusRepeat motifGenBank accession no.Repeat size (nt)bSHU S4 strain array size (nt)Largest array size (nt)Smallest array size (nt)No. of allelesDiversitya
Ft-V1 TTGGTGAACTTTCTTGCTCTT AY037288 2137440.7
Ft-V2 TTTCTACAAATATCTT AY037290 1618142100.53
Ft-V3 TTAATG AY037289 647520.36
Ft-V4 AATAAGGAT AY037287 925273200.93
Ft-V5 GT AY037291 256340.53
Ft-V6 TA AY037286 256420.51
Avg value0.53
  • a Diversity was determined by the equation D = 1 − Σ(allele frequency)2.

  • b nt, nucleotides.