Table 1.

VNTR PCR primer sequences

Primer nameForward sequenceReverse sequence
FT-V1GATTTTTGGGGTTTTCTCTAAACATTTCTAAAATCTGCTTATCGCAAAACATTATTACCTTATACAGGTTATGGTAGTGGAATC
FT-V2GTCATACCTTCTTCATGTTTATTAATTACGATGTCTCGTTCAGGTTAAAACTTTTCTATTGCCCATAGC
FT-V3GCGGTTTAGCTATTTTCAATATAATTTAAGTTTTTTGTGCGTTGGTAAGGTTTTTTATTTCTAGTGCTTTTTGATTATCC
FT-V4GAAATTCACTTACTCAACTGGGAGAATATAGCAAGGCGCAAATTTATTTTTAGGAGTCCACGTGGATCATC
FT-V5GTGGTCTTTTAAGCGTCTTAGCAAGCTCGACGGGTACCCATCCCATATGTAAGTACAAATGTAGC
FT-V6GGACCAGAATACTCATACCAAAGTCTATATAATGGTGAAGGCTCCATATTATTACTCAAAATAAATACCCTGAATATAAAAATATCATC
C1-C4TCCGGTTGGATAGGTGTTGGATTCGCGGATAATTTAAATTTCTCATA