Table 2.

Y. pestis VNTR loci and primers used for their amplificationa

Locus CO92 array No. of allelesDIbForward primer (5′ to 3′)Reverse primer (5′ to 3′)
M021 by 11 5 0.76GCCTTGGCGCTGACTCCATTGTGCHex-GGCCTATTTATCTTAACCACGACTGAACCTC
M06 2 by 6 20.17 Fam-GATAGATCTCCGAAGGCAGATCGCAATAGGTCGGGCGATAGGATAGCTTGATGCGTTGTTTTAC
M09 3 by 6 4 0.51Fam-GACCTCGATCTGCTTAGAACCTTTGTAGCTGTTGCGTTGCATTTGTTGGCTAACTGCTGACTGAGTTC
M12c4 by 10 7 0.82 GAAGCGGCAACAATTTACCGTTATTTATGCTNed-TTTATTCGCCTCCCCTTCGAACTTGAA
M15 5 by 2 40.57 GTCACCTCTCAGGCGGGAATCATCTCTCGCATAACGTCTTCAGTGCGTTGTGGC
M18 6 by 6 9 0.82GGGGTGTTAATTGTGAGGCGTGTTGTC Hex-CCCTACCCGCCACTCTCTTGGTAGC
M2 7 by 5 3 0.49Ned-GATTTATGAATGGCTACAACGTCGTCGCAGTAGTGATACAGGCAAATCCAAGAGCGCA
M22 7 by 12 9 0.82Fam-GCGTGATACCAAAGGCTGGCTCACC GGCACTTTGGGTACGGAACGTCATCAC
M23 7 by 6.5 9 0.83Hex-GTTAAAACTTAATTAACCAACTTAAGAGTCGCCATATCGTTATCAGATTTCGCTTGAAGTAGGTTTAACGATGAC
M25 7 by 20 100.83 Hex-GTTTAGCTGTAAATAGATTTAGAAGCCTCGTCTTTTGACGATATAAATGAGTTGATTCAGGTGTTCATATTTAACGAAAC
M26 8 by 2 20.49 GCTATTTTTTGCGGTTAGTCACATTTGATATTTGGTCCCTTTCCTCACTGGTTCGACTTGTAAG
M27 8 by 6 10 0.84Fam-GTCTAACTGGCGCGGCATTCTTGC GGGTGTTCTTATGTCATCCGCCAACAAAC
M28 8 by 7 7 0.75 GTTTGGCGGTTGGGCGTACCTTGGTANed-AGCGCCCGTAGACGCTTTCGAAATAGC
M29 8 by 8 70.83 Ned-GAGCGGCGGGTTCTCATGCTGATGTTTAAGCAGTAGATCTAAAGCGTTATGAATATTGGTGTTA
M31 8 by 8 70.78 Fam-GGTTTGCAGGTTTTTGTTGTGGATTATGGACTTAGATGGCGGGATGGCGTATCGGTTGC
M33 9 by 22 7 0.76Hex-AGCAACCTGTGCCGCCTCGATATAAG GAGACGGGCGAAATTGAAGCACAGTTAT
M34 9 by 6 11 0.81 Fam-GAATCGCGGGTTGACGCTGTTGAGCGCTGAACAGCCCCATAAAACCGGAGC
M36 10 by 1 2 0.38GTTAGACAAAACGTTTCTCGATGATTTGTAAGCGACAAACAATAAAAATTCACGATTTATACCCGTC
M37 10 by 6 50.72 GCCACAGGAAGAGGACATTTCAGAGAAAACGTTGCTAAAACGATACCGCTACGATCAGC
M41 12 by 2 3 0.15GCAGGGGACACCGAGCAGATTTATGC GCTTTCGCTTTAGGCCTGACCTGTTCTGC
M42 12 by 3 2 0.18 GCCGGTAGAGGCGTTGTCTTTGGTTTTTTCGTTTTGGGGTTCAGTGCACGCTTGTGAC
M43 12 by 5 4 0.69GAGTGCGCGACGGTATGGTGC GCCGCGCATTTATTGATGGTGTC
M49 14 by 3 2 0.44 GTAATACTTACGCCTTGGCAGCAGTGTTCACGACGTGGGGTGTTCTACGGTGGATTGTTTTTAGGC
M51 15 by 3 2 0.49GCAACCCGCTGAAGTTGTAAAAACCGAC GCGTTGATCTTCGCGGCCTTCAC
M5215 by 4 2 0.49 GTGGCCTAACCCGTTTTACCGGTGTAGCGCGGTTTTGTCAATCACGAATCAGGACTC
M54 16 by 3 3 0.57GTATGCTTAGCGCCAGTGATAACGAGTC GATCGCGTCATCGGGGTTTGTC
M5516 by 2 3 0.40GTCATGGGTGATGCTGTTGCTCTCATTTTATAGTTGTAGTGAGCCTTAATGGTTGAATGCGCGAATGAGTCAGATAAC
M56 17 by 2 30.40 GTGCCAGTGTTTCGAGCATAGCCAATGAAATACGTACCGCAGCCCAGACTCCTTACTGGAAAC
M58 17 by 7.5 6 0.78Hex-GCGATAACCCACATTATCACAATAACCAACACGCTGATGGAACCGGTATGCTGAATTTGC
M59 17 by 8 4 0.68Ned-GCTTAGCCGCCAGAAAAGGTGAGTTGGCGATAATGGCGGTAGCCGGAATCTGATAATCATC
M61 18 by 5 30.60 GCGCCACAATTAGGGCAACTGC GCCGCTTTAATGGTTTGTGAAATGAC
M65 19 by 2.5 3 0.29 GTTGTATGTGCGTTGGTTAGGGAAGGCGTCATTTACTCCGGTAGTTTATTGGGTATTGAAC
M66 20 by 2 30.50 GAGATGGATTAACCAGATGTCTTAAAAACTATCGTAACGCGAATCGGCGGCCCAAAC
M68 20 by 3 3 0.49GATAAAGCGCAATGGCAAGAGAAAGC GCCTGGCAATTGTTCAGCGAATC
M6921 by 2 2 0.00 GCGGTGCTGTTGTTAATGATTAGGTGTTCACGCCCTCATCACAAAATACCTAAAATAGTCAATAGC
M71 21 by 2 20.15 GCGTTGCCAGCCGCAGCGATAC GCACCCCTGCTCTGGGTCACGC
M7222 by 2 2 0.38 GCGACACGCCCTTTCAATGAGATACACGTAGATCACCGCTAAATGCGAAGGTCCAC
M73 30 by 2 2 0.28GCTTTCTGGCAATGCGATAGTTAGGCATCTC GTTAATTTAACTCAATATTGTCGCTATGGT
M74 36 by 2 2 0.28GATAGAATAGCGCTTCTTTTATTATTGAGATGATGAC GTGCTTGTGGCAGGTGGGTATGAC
M76 41 by 2 2 0.49 GCGGCCTGATAAGGGATATTGGAAGCGGCGAAATTCATTAAAGAGGATCCTGACAC
M77 45 by 4 2 0.15GAGTATTGCGAAGGGGTGATAAATGAAGCGTGCCAGAGTCCTTGGTTAAACAAATAGAAGAAC
M79 8 by 10 100.86 Fam-GCCCTTATCTACTGGGCCAAGCTAACGCGCCATGGCGGGATGTAATGGCAC
  • a The primers marked by an asterisk have a phosphoramidite fluorescent dye (Fam, Hex, or Ned) covalently linked to the 5′ nucleotide.

  • b DI, Nei's diversity index.

  • c The same VNTR locus as that described by Adair et al. (2); however, the PCR primers differ.