Table 2.

Species-specific and nucleotide-sequencing PCR primers used in study

Specificity and primer nameSequence (5′ to 3′)aPositionPCR annealing temperature (°C)Product size
Universal 16S rDNA primer
 UNI2GACTCCTACGGGAGGCAGCAG336–356b 601,020 bpc
 UNI5a CTGATCCGCGATTACTAGCGATTC1337–1360b
B. cepacia complex recA
 BCR1TGACCGCCGAGAAGAGCAA2–20d 581,043 bpd
 BCR2a CTCTTCTTCGTCCATCGCCTC1044–1024d
recA sequencing primers
 BCR3GTCGCAGGCGCTGCGCAA513–530d 58532 bp,d 3′ half of B. cepacia complexrecA gene in combination with primer BCR2
 BCR4a GCGCAGCGCCTGCGACAT528–511d 58527 bp,d 5′ half of B. cepacia complexrecA gene in combination with primer BCR1
B. cepacia genomovar I
 BCRG11CAGGTCGTCTCCACGGGT 112–129e 62492 bpe
 BCRG12a CACGCCGATCTTCATACGA 603–585e
B. multivorans (Bm)
 BCRBM1CGGCGTCAACGTGCCGGAT 321–339d 62714 bpd
 BCRBM2a TCCATCGCCTCGGCTTCGT 1034–1016d
B. cepacia genomovar III-A
 BCRG3A1GCTCGACGTTCAATATGCC 294–309f 62378 bpf
 BCRG3A2a TCGAGACGCACCGACGAG 671–654f
B. cepacia genomovar III, RG-B
 BCRG3B1GCTGCAAGTCATCGCTGAA 228–246g 60781 bpg
 BCRG3B2a TACGCCATCGGGCATGCT 1008–991g
B. cepacia genomovar IV, RG-4
 BCRG41ACCGGCGAGCAGGCGCTT 361–378h 64647 bph
 BCRG42a ACGCCATCGGGCATGGCA 100–990h
B. vietnamiensis, RG-BV
 BCRBV1GGGCGACGGCGACGTGAA 84–101i 62378 bpi
 BCRBV2a TCGGCCTTCGGCACCAGT 461–444i
  • a Base positions in primer sequence which were mismatched in other genomovars are underlined.

  • b Position in relation to Escherichia coli 16S rRNA gene (GenBank accession number J01859).

  • c Size in relation to B. cepacia 16S rRNA gene (GenBank accession number X87275).

  • d Size and position in relation to B. multivorans ATCC 17616 recA sequence U70431.

  • e Size and position in relation to B. cepacia genomovar I strain ATCC 17759 recA (Table 1).

  • f Size and position in relation to B. cepacia genomovar III-A strain K56-2 recA (Table 1).

  • g Size and position in relation to B. cepacia genomovar III-B strain C1394 recA (Table 1).

  • h Size and position in relation to B. stabilis strain LMG14291 recA (Table 1).

  • i Size and position in relation to B. vietnamiensis strain C2822 recA (Table 1).