Table 1.

Oligonucleotides used in this study to detect B. pertussis and B. parapertussis

Oligonucleotide
Sequence
DFPOR1F5′GGCTCCTTGACTGAACTGG3′
DFPOR2F5′TGAGGTCGGGCGAATCGTC3′
DFPORRB5′Biotin-GGTAAGTTGCAACATCCTGTC3′
DFPORP15′GAACCATGCATACAACCTATT3′
DFPORP25′GAGCTTGTTGCATTGCGATGC3′
DFPORP35′CGCGCGCGATTCCGGATTAAG3′
DFPORFMB5′GGCTCCTTGACTGAACTGGCTGTGGCATCCATGAAAC3′
DFPORRMB5′GGTAAGTTGCAACATCCTGTCGCATAGAGGTCTTTACGGA3′
DFMBAP5′TCAATTCCATCATGAAGTGTGACGTTGA3′