TABLE 3

Primer and molecular-beacon sequences used in this studya

Assay (amplicon sizes in 1st/2nd PCRs [bp])aPrimer or beaconSequence (5′ to 3′)
BA-Pag (122/81)PagOFGGGAAAGAACTTGGGCTGAA
PagORCGAAGTCGTTGGTAACACGTTG
PagIFCCGCTGATACAGCAAGATTAAATGC
PagIRTCGTTGGTAACACGTTGTAGA
Pag probeCF3ccgcgGATATGTAAATACTGGGACGGCTCCcgcggCDQ38
IC (246/159)IC_FAGCGCTTGCGGCAAACACGGAGAAA
IC_ORGCGACACCGGCGAATACAGAGATACC
IC_IRGCTCCACCGAACAATCCGATCTTACCGCCC
IC-probeCF11ccgCGACAGAC(A01)AGCTCCGTCA(T42)TTGATCGcggDAB
  • a BA-Pag, Bacillus anthracis protective antigen; IC, internal control; OF, outer PCR forward primer; OR, outer PCR reverse primer; IF, inner nested PCR forward primer; IR, inner nested PCR reverse primer; CF3 and CF11, fluorophores; CDQ38 and DAB, quenchers. Lowercase letters in the sequences indicate the nontarget sequence used in the molecular probe.