Table 1.

Sequences of oligonucleotide primers and probes

Oligonucleotide probe or primerSequence (5′ to 3′)Source or referenceOligonucleotide labeling
PCR primers
 ITS1TCCGTAGGTGAACCTGCGG31Universal forward primer
 ITS4TCCTCCGCTTATTGATATGC31Universal reverse primer
Probes
 ITS3-BGCATCGATGAAGAACGCAGC315′-Biotin-labeled universal capture probe
 DmGGACGTGCCCGAAATGCAGTGGCGGU18363a5′-Digoxigenin-labeled probe for all endemic dimorphic fungi
 HcACCATCTCAACCTCCTTTTTCACACCAGGU183635′-Digoxigenin-labeled probe for H. capsulatum
 BdGGTCTTCGGGCCGGTCTCCCCU183645′-Digoxigenin-labeled probe for B. dermatitidis
 CiCTCTTTTTTTTATTATATCCU183605′-Digoxigenin-labeled probe for C. immitis
 PbCACTCATGGACCCCGGAF3223895′-Digoxigenin-labeled probe for P. brasiliensis
 SsGACGCGCAGCTCTTTTTAAF1179455′-Digoxigenin-labeled probe for S. schenckii
 PmGGGTTGGTCACCACCATAL374065′-Digoxigenin-labeled probe for P. marneffei
 CnCCTATGGGGTAGTCTTCGGL140685′-Digoxigenin-labeled probe for C. neoformans
 PcGTAGTAGGGTTAATTCAATTL276585′-Digoxigenin-labeled probe for P. carinii
  • a GenBank sequence accession number.