Table 2.

PCR primers used in this study

Oligo-nucleotideSequence (5′→3′)Position in geneFunction
MU3CGCGTGGGTCCCTCGGGTCT145–126MU3 and MU4 are outward PCR primers for amplifying between tandem copies of IS2404
MU4ATCGCCGAAGCCTGCCGGAT1116–1135
MU5AGCGACCCCAGTGGATTGGT383–401MU5 and MU6, 492-bp PCR product from IS2404
MU6CGGTGATCAAGCGTTCACGA852–871
MU7GGCCTGGCGGATTGCTCAAGG213–233MU7 and MU8, 332-bp PCR product from IS2606
MU8CGTAGATGTGGGCGAAATGG542–523
MYCGENFAGAGTTTGATCCTGGCTCAG16–35a MYCGENF and MYCGENR, 1,030-bp PCR product from all 16S rRNA gene in (3)
MYCGENRTGCACACAGGCCACAAGGGA1046–1027a
  • a Numbering is based on the E. coli 16S rRNA gene.