Table 1.

PCR primers for amplification of cagA used in this study

Primer designation (polarity)Primer sequence (5′→3′)Position
cagP1 (+)CCATTTTAAGCAACTCCATAAACC552–575a
cagF1 (+)TGGGTAAAAATGTGAATCGT858–877a
cagF2 (+)AAGATACCGATAGGTATGAA1032–1051a
B1 (−)b TCTGCCAAACAATCTTTTGCAG1557–1578a
cagAF (+)Bioc-TTGACCAACAACCACAAACCGAAG1090–1113a
cagAR (−)Bio-CTTCCCTTAATTGCGAGATTCC1251–1272a
cagEF (+)d GCGATTGTTATTGTGCTTGTAG16891–16870e
cagER (−)d GAAGTGGTTAAAAAATCAATGCCCC16563–16587e
cagTF (+)d CCATGTTTATACGCCTGTGT442–461e
cagTR (−)d CATCACCACACCCTTTTGAT723–742e
  • a Positions corresponding to thecagA ORF of H. pylori ATCC 53726 (GenBank accession no. L11714).

  • b Tummuru et al. (37).

  • c Bio, biotin moiety at the 5′ end of the primer.

  • d Ikenoue et al. (17).

  • e Positions according to the sequence with GenBank accession no. U60176.