Table 1.

Base sequences of the staphylococcal toxin-specific oligonucleotide primers and predicted sizes of amplified products

GeneaGenBank accession no.PrimerOligonucleotide sequence (5′→3′)Size of amplified productb (bp)Reference
seaM18970SEA-1TTGGAAACGGTTAAAACGAA12012
SEA-2GAACCTTCCCATCAAAAACA
sebM11118SEB-1TCGCATCAAACTGACAAACG47812
SEB-2GCAGGTACTCTATAAGTGCC
secX05815SEC-1GCATAAAAGCTAGGAATTT25712
SEC-2AAATCGGATTAACATTATCC
sedM28521SED-1CTAGTTTGGTAATATCTCCT31712
SED-2TAATGCTATATCTTATAGGG
seeM21319SEE-1CAAAGAAATGCTTTAAGCAATCTTAGGCCAC48212
SEE-2CTTACCGCCAAAGCTG
segAF064773SEG-1AATTATGTGAATGCTCAACCCGATC642This study
SEG-2AAACTTATATGGAACAAAAGGTACTAGTTC
sehU11702SEH-1CAATCACATCATATGCGAAAGCAG375This study
SEH-2CATCTACCCAAACATTAGCACC
seiAF064774SEI-1CTCAAGGTGATATTGGTGTAGG576This study
SEI-2AAAAAACTTACAGGCAGTCCATCTC
tstJ02615TSST-1ATGGCAGCATCAGCTTGATA35012
TSST-2TTTCCAATAACCACCCGTTT
etaM17347ETA-1CTAGTGCATTTGTTATTCAA11912
ETA-2TGCATTGACACCATAGTACT
etbM17348ETB-1ACGGCTATATACATTCAATT20012
ETB-2TCCATCGATAATATACCTAA
  • a Genes encoding SEA to SEE, SEG to SEI, TSST-1, ETA, and ETB.

  • b Size of PCR product derived from published GenBank sequences.