Table 4.

Primers used in PCR amplifications

PrimerSequence (5′ to 3′)Annealing temp (°C)
MFαUTTCACTGCCATCTTCACCACC55
MFαLTCTAGGCGATGACACAAAGGG55
660UTATTGGACTAAAACGGTATGCGG55
660LCGACGACGAGGTATTCTTTTTCC55
STE12αUCAATCTCAAAGCGGGGACAG50
STE12αLCTTTGTTTCGGTCCTAATACAGCC50