Table 2.

Thirteen taxon-specific primer pairs that amplify a fragment of the 28S rDNA from Zygomycetes

PCR primer pair (5′ to 3′)Zygomycetes species identifiedSize of PCR product (bp)
Acl1(ATCATGCGTTTGCCCTTTAGC)Absidia coerulea477
Acl2 (CTAAGCGAGAAAAAAGAGAAAC)
Acy1 (CGGATTGTAAACTAAAGAGCG)Absidia corymbifera577
Acy2 (CCAAAGTAGATTACAGTTCTAG)
Ap1(GAATTGTAAACTTTAGAGTCGTTG)Apophysomyces elegans453
Ap2 (TGAACCACAGTATTTCGCGAA)
Ba1(AAAATCTGTAAGGTTCAACCTTG)Basidiobolus haptosporus651
Ba2 (TGCAGGAGAAGTACATCCGC)Basidiobolus ranarum
Cc1(TCTCTTAACTTGCTTCTATGCC)Conidiobolus coronatus419
Cc2 (CTTTAATTAAGCTAATCAACATG)
Cr1(GTGAGAATCCCGTGAATTCAC)Cokeromyces recurvatus434
Cr2 (CAAAGCACTCAACTATTTCGC)
Cu1GGATTGTAAACTAAAGTTTTCCunninghamella bertholletiae521
Cu2 AAATTCTCTAATTATTCCCTCCunninghamella elegans
Cunninghamella polymorpha
Mc1 ATTTTCCTGGCACACCAGATTMucor circinelloides538
Mc2GCGAATAAAAAATATACTAGATGTMucor ramosissimus
Mp1 TGGCCGGTTTACTGGTCCGAAMortierella polycephala618
Mp2 CGAGTATAAAAAGGACACGGC
Rh1 TTTTCCAGGCAAGCCGGACCGRhizopus azygosporus469
Rh2TATTCCCAGCCAACTCGCCAAATRhizopus microsporus
Ro1 AGCATTTGCCTTTTGTGATACGCRhizopus oryzae413
Ro2 ACCGTAGTACCTCAGAAAACC
Rm1 TCTATTGCGATGCATGCTCCRhizomucor miehei305
Rm2GGTCTCTTTAGACTCCAAAGCRhizomucor pusillus
Sv1 CTTTGGCTTGAGCATTGGACSaksenaea vasiformis433
Sv2AGACTAAATCAATGACTTCTGG