TABLE 2

PCR primers used for amplification

LocusProductPrimerPrimer sequence (5′–3′)Annealing temp (°C)Reference
ITSITS1-5.8S rRNA gene-ITS2ITS1TCCGTAGGTGAACCTGCGG4840
ITS4GCTGCGTTCTTCATCGATGC40
LSUD1/D2LR0RACCCGCTGAACTTAAGC4541
LR05TCCTGAGGGAAACTTCG42
Rpb2RNA polymerase IIRpb2-6FTGGGGKWTGGTYTGYCCTGC5143
Rpb2-7RCCCATWGCYTGCTTMCCCAT43
Tef1αTranslation elongation factor 1 alphaYTEF-1GGGTAAGGGTTCTTTCAAGTACGCTTGGG5144
YTEF-6GCGTTCTTGGAGTCACCACAGACGTTACCTC44
ActActinCA14AACTGGGATGACATGGAGAAGATCTGGC5145
CA5RGTGAACAATGGATGGACCAGATTCGTCG45