TABLE 2.

Sequences of dru regions found in 30 USA300-0114 isolatesa

dru typeSequence
9g5′ATAAGAGGAATAGTAAAAGCAATTCTAAGTAAAATTGCAG
ATAAGAGGTTTGTTAAAAGCAGTTCTCAGTAAAATTACAG
ATAAGAGGTACGTTAAAAGCAGTTCTAAGTAAAATTGCAG
ATAAGAGGTTTGTTAAAAGCAGTTCTAAGTAAAATTGCAG
ATAAGAGGTACGTTAAAAGCAATTCCATGCAAAATTGCTG
ATAAGGGGTAAGTTAAAAGCAGTTCTCAGTAAAATTGCAG
ATAAGAGGTACGTTAAAAGCAGTTCTAGGCAAAATTGCAG
ATAAGAGGTGCGTTAAAAGCAGTTCTCAGTAAAATTGCTG
ATAAGGGGTAAGTTAAAAGCAATCCTAAGTAAAATTGCAG3′
9h5′ATAAGAGGAATAGTAAAAGCAATTCTAAGTAAAATTGCAG
ATAAGAGGTTTGTTAAAAGCAGTTCTCAGTAAAATTACAG
ATAAGAGGTACGTTAAAAGCAGTTCTAAGTAAAATTGCAG
ATAAGAGGTTTGTTAAAAGCAGTTCTAAGTAAAATTGCAG
ATAAGAGGTACGTTAAAAGCAGTTCTAAGTAAAATTGCAG
ATAAGAGGTTTGTTAAAAGCAGTTCTAAGTAAAATTGCAG
ATAAGAGGTACGTTAAAAGCAATTCCATGCAAAATTGCTG
ATAAGGGGTAAGTTAAAAGCAGTTCTCAGTAAAATTGCAG
ATAAGAGGTACGTTAAAAGCAATCCTAAGTAAAATTGCAG3′
  • a As noted in the text, type 9g was found in 29 of the 30 isolates, while type 9h was found in only 1 isolate. Sequences (from top to bottom) are listed as they occurred in tandem in the 5′ to 3′ direction. Sequence analysis was based on using ATAAGAGGTA CGTTAAAAGC AGTTCTAAGT AAAATTGCAG as the consensus sequence (30).