TABLE 1.

RT-LAMP E1 gene primer sets designed for rapid and real-time detection of Chikungunya virus

PrimerGenome positionaLength of oligonucleotide (bp)Sequence
Forward outer (F3)10294-1031219ACGCAATTGAGCGAAGCAC
Backward outer (B3)10498-1048019CTGAAGACATTGGCCCCAC
Forward inner primer (FIP) (F1c + TTTT + F2)10378-10357 (F1c)22CGGATGCGGTATGAGCCCTGTA
10316-10335 (F2)20TGGAGAAGTCCGAATCATGC
Backward inner primer (BIP) (B1 + TTTT + B2c)10391-10413 (B1)23TCCGCGTCCTTTACCAAGGAAAT
10472-10453 (B2c)20TTGGCGTCCTTAACTGTGAC
Forward loop primer (FLP)10355-1033917GCTGATGCAAATTCTGT
Backward loop primer (BLP)10430-1044617CCTATGCAAACGGCGAC
  • a S27 (African prototype strain) (GenBank accession no. AF369024).