TABLE 2.

Genes used for MLST

GeneGene productPrimer (direction, sequence [5′-3′])aAmplicon size (bp)Sequence startSequence endGene length (bp)No. of SNPsNo. of genotypesNo. of genotypes/site
ADE2Phosphoribosylamino-imidazole carboxylaseFwd, GTCACTTCTCAGTTTGAAGC600AAACAAATCTCATTTA4709212.33
Rev, ACACCATCTAAAGTAGAGCC
HIS3Imidazole glycerol phosphate dehydrataseFwd, GGAGGGGACATATCACTGCC534AATCCCAAGTTGATTG4008141.75
Rev, AATCTTTAATTGCCAAAGCC
LEU2Isopropyl malate dehydrogenaseFwd, CTGTGAGACCAGAACAGGGG802GTAACTTTAAGCTCTC6199171.89
Rev, GCAGAGCCACCCAAGTCTCC
LYS2l-Aminoadipatesemialdehyde dehydrogenaseFwd, ATCTGAGAAGCAGTTGGCGC631AAAGATTGTCTGAACT44110191.90
Rev, AGACTTGTAAGAATTATCCC
NMT1N-MyristoyltransferaseFwd, CTGATGAAGAAATCACCG738GCTTCATTTGAAGTGAA53711222.00
Rev, GCTTGATATCATCTTTGTCC
TRP1Phosphoribosylanthranilate isomeraseFwd, AGCTATGTCGAGCAAAGAGG503ATATGAGGCAGGTGGG38011222.00
Rev, ACATCAACGCCACAACACCC
  • a Fwd, forward; Rev, reverse.