TABLE 1.

Primers used for testing of LSPs

Name of LSPPrimer 1 sequence (forward)Primer 2 sequence (reverse)Primer 3 sequence (reverse)Product size (bp)a
LSP presentLSP absent
LSPA 8CCAGGTCGAAGAGGTGCTCCCTATACCGCCAACGACATCGTGCTGCCGTCCAGGTAG222399
LSPA 17CTGGAGTACTTCCACGACCAGTCCAGGAAGAACCGGAACGCACTCGAATTCACGAAATG202398
LSPA 20GGCGTTACAGAATTGCCTTGGCTCGAAGTTGGAGATCAGGGTACGTGGTGACCAATGTCG197306
LSPA 4-IITAGAAGGTGCGGGAAAGTTGGTCTATCTGGCGGTGCTCTCGTCGAAGCAGCGTTGATTGT540462
LSPA 18GACGTCCTGATCATCGGTTCGTCCACCGAGGAGGTCAG1,967
LSPA 18GTAGTAGTCGTCGCCCAGCAGTGGGATCACGACCTGGAC403
  • a For all but one LSP (LSPA 18), PCR tests were done using the three primers in a multiplex PCR; expected product sizes are listed in the last two columns. Primers 1 and 3 are the bridging primers, and primer 2 is the internal primer. For LSPA 18, PCR testing was performed using two primers only, such that a product was obtained with one set of (bridging) primers when the region was missing and one set of (internal) primers when the region was present.