TABLE 3.

Extension primer sequences for the SNaPshot reaction

Primer targetPrimer nameSequence (5′→3′)
16S rRNA125SFTTTTTTTTTTAACGGGTGAGTAACACGTGGG
141SRTTTTTTTCAGTTTCCCAGGCTTATCCCR
231SRTTTTTAAGCTGATAGGCCGCGGGC
264SRCGTCGTCGCCTTGGTRGGCC
471SR1TTTTTTTTTTTTTTTTTTTTTTTTTTGCTTCTTCTCCACCTACCGTCA
471SR2TTTTTTTTTTTTTTTTTTTTTTTTTTCCTTCTTCTGTAGGTACCGTCA
Hsp65163SRTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCTTGGTCTCGACSTCCTTGGC
235SRTTTTTTTTTTGTCCATSGCCTCGGCGATCAGGTC
265SFTTTTTTTTTTTTTTTTTTATCGCCGAGGCSATGGACAAGGT