TABLE 2.

Primer sequences, size of fragment, and percent coverage of complete coding sequence for each gene analyzed in this studya

GeneSize of fragment (bp)Coverage of complete CDS (%)PCR and sequencing primers (5′-3′)Reference or source
MVLST genes
    prfA46965.69AACGGGATAAAACCAAAACCA (F)60
TGCGATGCCACTTGAATATC (R)
    inlB43322.87CATGGGAGAGTAACCCAACC (F)60
GCGGTAACCCCTTTGTCATA (R)
    inlC41846.91CGGGAATGCAATTTTTCACTA (F)60
AACCATCTACATAACTCCCACCA (R)
    dal44141.10GGTTTCTGCGTAGCCATTTT (F)60
GGAAGGGGTCAATCCATACA (R)
    clpP41970.18CCAACAGTAATTGAACAAACTAGCC (F)60
GATCTGTATCGCGAGCAATG (R)
    lisR44865.70CGGGGTAGAAGTTTGTCGTC (F)60
ACGCATCACATACCCTGTCC (R)
Additional virulence genes
    inlA45819.01GCTTTCAGCTGGGCATAAC (F)This study
ATTCATTTAGTTCCGCCTGT (R)
    actA58232.01AAGAGGTAAATGCTTCGGACT (F)This study
ATTCCATTTAGTTCCGCCTGT (R)
  • a CDS, coding sequence; F, forward; R, reverse.