TABLE 1.

Sequences, polarities, targets, and amplicon sizes corresponding to the primers and probes used for routine surveillance of viral GE outbreaks

Virus or probeTargetPrimerPolaritySequence (5′ to 3′)fNucleotide positionAmplicon size (bp)
Norovirus GGICapsidNV1LCF+CARGCCATGTTYCGYTGGATG5279-5299a98
CapsidNV1LCRCCTTAGACGCCATCATCATTTAC5354-5376a
Norovirus GGI probeCapsidNV1LCprVIC-TGGACAGGAGAYCGCRATCT-TAMRA5321-5340a
Norovirus GGIICapsidNV2LCF+GARYCIATGTTYAGRTGGATG5000-5020b95
CapsidNV2LCRTCGACGCCATCTTCATTCAC5075-5094b
Norovirus GGII probeCapsidNV2LCprFAM-TGGGAGGGSGATCGCRATCT-TAMRA5042-5061b
RotavirusVP1, core proteinABC F+TAYACIGAYGTITCICARTGGGA1578-1600c385
VP1, core proteinABC RGTAGTTGTCGTCICCRTCIAC1896-1916c
AstrovirusCapsidAC′1+ATGGCTAGCAAGTCTGACAAG4326-4346d231
CapsidAC230GGTTTTGGTCCTGTGACACC4542-4561d
AdenovirusHexon proteinHEXAA1885+GCCGCAGTGGTCTTACATGCACAT17663-17686e308
Hexon proteinHEXAA1913CAGCACGCCGCGGATGTCAAAGT17941-17963e
  • a Norwalk virus complete coding sequence; accession number M87661.

  • b Norwalk-like virus strain GIFU′99 complete genome; accession number AB084071.

  • c Human rotavirus C VP1 gene for structural protein VP1 from genomic RNA; accession number AJ304859.

  • d Human astrovirus type 8 complete genome; accession number AF260508.

  • e Human adenovirus F complete genome; accession number L19443.

  • f TAMRA, 6-carboxytetramethylrhodamine; FAM, 6-carboxyfluorescein.