TABLE 2.

PCR primers used for the validation of the CGH data

Locus tagGenePrimerPrimer sequence (5′-3′)
SACOL0046SA0046FAAGTGCTTCATACACCGGGTCACA
SA0046RAGCCTCCTTACTGCGGAGATCAAA
SACOL0143cap5HSA0143FTGACCAACCAAGCCGTACAACA
SA0143RTTCTCCCACCACTTGCTTTCCA
SACOL0144cap5ISA0144FAGGGTTTGGTCCGCATGAAGAAGT
SA0144RCGGCGTAACTTCCTTTAGAACAATGCC
SACOL0145cap5JSA0145FACCCAAGAAATTCCGCGAGGGTTA
SA0145RGCCTAATCCGGCAGTAAATGCTGA
SACOL0886sekSA0886FTCTAATAGTGCCAGCGCTCAAGGT
SA0886RGGTAACCCATCATCTCCTGTGTAG
SACOL0887seiSA0887FTGGTGGAATTACGTTGGCGAATCA
SA0887RTCTGCTTGACCAGTTCCGGTGTAA
SACOL1871epiGEpiGF1AAGCAAGCGCTCACATTTGTACCC
EpiGR1GAACCACGAATGATCTCCAAGCAC
SACOL1872epiEEpiEF1ACGGGAACAGCGAATAGTGTGTCA
EpiER1AGCGTAATAAGCGGGATTCTCTGC
SACOL1874epiPEpiPF1TGAACCGGAGGAAACAGGTGATGT
EpiPR1CATTACCAGCTGCAGCAACAACGA
SACOL1876epiCEpiCF1AGTGGATTAGCTGGGATAGGGAGA
EpiCR1ACCCGTATTGCCATAACACCAACC
SACOL2196SA2196FTGTATTGACAGGAAGTACATTTCAAAGTG
SA2196RGTTCAAGATAGCTTAAATATGCTTCGTC
SACOL2507sarUSA2507FGAAACGAAGCAGATGAACGCCGTA
SA2507RCATCTGCAAGGGATCGTTCTTTGA