TABLE 1.

PCR primers for SAgs

Primer namePrimer sequence (5′ to 3′)Approximate size (bp)
SEA forwardATTGTTTTGGGGGAGTTTGAAGTT400
SEA reverseTACATTGCGTTTTATTGGTTGCTC
SEB forwardGTATGATGATAATCATGTATCAGCAATA640
SEB reverseCGTAAGATAAACTTCAATCTTCACATC
SEC forwardGAGTCAACCAGACCCTATGCC610
SEC reverseCGCCTGGTGCAGGCATC
SED forwardGAGACTAGCCGCAATCTATCC650
SED reverseGCTGCATTTAGTAATGCTGGCTG
SEE forwardGGTAGCGAGAAAAGCGAAG450
SEE reverseGCCTTGCCTGAAGATCTAGCTC
SEG forwardTGAATGCTCAACCCGATCCTAAAT580
SEG reverseCAAACCAAAAACTTGTATTGTTCTTTTCA
SEH forwardTTCACATCATATGCGAAAGCAGAA620
SEH reverseCAGATTTTAAAGTTTTATTGTCTTCA
SEI forwardCGTATGCTCAAGGTGATATTGGTG580
SEI reverseAAAAACTTACAGGCAGTCCATCTCC
SEl-J forwardTTTAGGATCCCTACAGAACCAAAGG900
SEl-J reverseGTTTCCATGGATAGCAAAAATGAAAC
SEl-K forwardGTGTCTCTAATAATGCCAGCGCTC650
SEl-K reverseTTTGGTAGCCCATCATCTCC
SEl-L forwardCACCAGAATCACACCGCTTA450
SEl-L reverseTCCCCTTATCAAAACCGCTAT
SEl-M forwardTTTTGCTATTCGCAAAATCATATCGCA800
SEl-M reverseTCAACTTTCGTCCTTATAAGATATTTCTAC
SEl-N forwardTGAGATTGTTCTACATAGCTGCAA720
SEl-N reverseAATTAGATGAGCTAACTGTTCTATTATCAC
SEl-O forwardTAGTGTAAACAATGCATATGCAAATG950
SEl-O reverseATTATGTAAATAAATAAACATCAATATGATA
SEl-P forwardGGAAGCTAAAGCAGAGACAC660
SEl-P reverseCCCGTTTCATATGAAGTGCCACC
SEl-Q forwardGCTTCAAGGAGTTAGTTCTGG500
SEl-Q reverseCTCTCTGCTTGACCAGTTCCGGTG
TSST-1 forwardGAAATTTTTCATCGTAAGCCCTTTGTTG625
TSST-1 reverseTTCATCAATATTTATAGGTGGTTTTTCA