TABLE 1.

Primer sets used for amplification of 18S rRNA genes in LAMP

SpeciesPrimerSequence (5′→3′)
Plasmodium genusF3GTATCAATCGAGTTTCTGACC
B3cCTTGTCACTACCTCTCTTCT
FIP (F1c-F2)TCGAACTCTAATTCCCCGTTACCTATCAGCTTTTGATGTTAGGGT
BIP (B1-B2c)CGGAGAGGGAGCCTGAGAAATAGAATTGGGTAATTTACGCG
LPFCGTCATAGCCATGTTAGGCC
LPBAGCTACCACATCTAAGGAAGGCAG
P. falciparum F3TGTAATTGGAATGATAGGAATTTA
B3cGAAAACCTTATTTTGAACAAAGC
FIP (F1c-F2)AGCTGGAATTACCGCGGCTG GGTTCCTAGAGAAACAATTGG
BIP (B1-B2c)TGTTGCAGTTAAAACGTTCGTAGCCCAAACCAGTTTAAATGAAAC
LPFGCACCAGACTTGCCCT
LPBTTGAATATTAAAGAA
P. vivax F3GGAATGATGGGAATTTAAAACCT
B3cACGAAGTATCAGTTATGTGGAT
FIP (F1c-F2)CTATTGGAGCTGGAATTACCGCTCCCAAAACTCAATTGGAGG
BIP (B1-B2c)AATTGTTGCAGTTAAAACGCTCGTAAGCTAGAAGCGTTGCT
LPFGCTGCTGGCACCAGACTT
LPBAGTTGAATTTCAAAGAATCG
P. malariae F3CAAGGCCAAATTTTGGTT
B3cCGGTTATTCTTAACGTACA
FIP (F1c-F2)TATTGGAGCTGGAATTACCGCGATGATGGGAATTTAAAACCT
BIP (B1-B2c)AATTGTTGCAGTTAAAACGCCTATGTTATAAATATACAAAGCATT
LPFGCCCTCCAATTGCCTTCTG
LPBTCGTAGTTGAATTTCAAGGAATCA
P. ovale F3GGAATGATGGGAATTTAAAACC
B3cGAATGCAAAGAACAGATACGT
FIP (F1c-F2)TATTGGAGCTGGAATTACCGCGTTCCCAAAATTCAATTGGAGG
BIP (B1-B2c)GTTGCAGTTAAAACGCTCGTAGTGTATTGTCTAAGCATCTTATAGCA
LPFTGCTGGCACCAGACTTGC
LPBTGAATTTCAAAGAATCAA