TABLE 1.

Primer sequences for fluorescent (LUX) and unlabeled primers

Primer nameSequencea
L1FAM-caaccaCAGGGTATGATAGGCTATTGGtTG
L2JOE-gacattgTTGGATACTTGTGGTGCAATGtC
L4JOE-cacaaaGCCCCATCAATATCAGTTTGtG
L5FAM-cacaaaGCCCCATCAATATCAGTTTGtG
L1AFAM-gtatccCGGCAATGCCATTGGAtAC
L2BJOE-gacattgTTGGATACTTGTGGTGCAATGtC
L6FAM-caccttACGTCAAATGCGTGAAGGtG
L7JOE-catcaaTGCGTGAAGGTGAAGTTGAtG
L8FAM-caatccCCTTGTGAATCAAGTTCTGGAtTG
L9JOE-caatccCCTTGTGAATCAAGTTCTGGAtTG
L10JOE-caatcgTTGATGATTTACCAGTTCCGAtTG
L11FAM-caatcgTTGATGATTTACCAGTTCCGAtTG
L12JOE-cagcttCTGCGACAAGTGAATTGAAAGCtG
L13FAM-cagcttCTGCGACAAGTGAATTGAAAGCtG
L20JOE-gatctgTGAAGGGAATGCAGCAGAtC
L14FAM-gtacttcaCGGGATTTGCAGAATTTGAAGtAC
L18AJOE-cacgcTAGGTGTTGTGCCTATGCGtG
L16FAM-cacctgTATCTCTAACGGCTTGTCAGGtG
L22JOE-caccgAACTTCTAATGACACTGGCGGtG
U1CGTATAAAAAGGACCAATTGGTCTG*
U2CGTATAAAAAGGACCAATTGGTCTA*
U3CGTATAAAAAGGACCAATTGGTCTT*
U4GTAAATCATCAACATCTGAAGATATG
U5GTAAATCATCAACATCTGAAGATGTG
U6GTAAATCATCAACATCTGAAGATGTA
U7GATCATCTTTATCTACTTCCACACGTGCA*
U8GATCATCTTTATCTACTTCCACACGTGCT*
U9ACCTACTAATCGCTCTCTCAAGTAA*
U10ACCTACTAATCGCTCTCTCAAGTAT*
U11TGCAGCACATTCAACAGAA
U12TGCAGCACATTCAACAGAC
U13TGCAGCACATTCAACAGAT
U14GATGAAGAAATTAACAAAAAAGCGCCT
U15GATGAAGAAATTAACAAAAAAGCGCCC
U16TTGCACAATCACCAAAGATGTATTATA*
U17TTGCACAATCACCAAAGATGTATTATT*
U18TTGAGCTGTCTTGGTTCATTGATT
U19AAACACTACTTGTTCCCGCTTCA
U20GGTCAGAGCCACGTTCACCA
U21TGCTTCAACATCCCAACCAA
U22TGGACACCGTCTTTATCAACGTCT
S1CAGGGTATGATAGGCTATTGGTTG
S2GCCCCATCAATATCAGTTTGTG
S3ACGTCAAATGCGTGAAGGTG
S4CCTTGTGAATCAAGTTCTGGATTG
S5TTGATGATTTACCAGTTCCGATTG
S6CTGCGACAAGTGAATTGAAAGCTG
aroE252GFGGTATAATACAGATGGTATCGGTTATGTG
aroE252GRACCTGCGCCCAAAATTAAAA
spaFAGCACCAAAAGAGGAAGACAA
spaRGTTTAACGACATGTACTCCGT
mecAFGATCGCAACGTTCAATTTAATTTTG
mecARGCTTTGGTCTTTCTGCATTCCT
  • a Boldface type indicates a polymorph at the SNP; lowercase type indicates hairpin loop structures of LUX primers. *, SNP is in reverse primer.