TABLE 1.

HRSV-A and -B oligonucleotide primers and probes used in this study

Primer or probeGenePositionsaSequence (5′→3′)PolarityReference
RT-PCR primers
    HRSV-A
        G267G248-267ATGCAACAAGCCAGATCAAG+ 39
        G511G511-531GGGTACAAAGTTAAACACTTC 15
        F164F164-186GTTATCACACTGGTATACC AACC 39
    HRSV-B
        BGFG169-192GCAGCCATAATATTCATCATCTCT+ 48
        BGRG-F5637-5658TGCCCCAGRTTTAATTTCGTTC 48
qRT-PCR primers
    HRSV-A
        AFFF669-695CTGTGATAGARTTCCAACAAAAGAACA+This study
        AFRF718-745AGTTACACCTGCATTAACACTAAATTCCThis study
    HRSV-B
        BNFN435-458GGCTCCAGAATATAGGCATGATTC+This study
        BNRN480-508TGGTTATTACAAGAGCAGCTATACACAGTThis study
MGB probes
    HRSV-A, F-TPF697-715CAGACTACTAGAGATTACC+This study
    HRSV-B, N-TPN461-477TATCATCCCACAGTCTGThis study
Sequencing primers
    HRSV-A, G599G599-619GCTTGGTGGTGGTTTTCTTTC 49
    HRSV-B
        G640G640-662AGAGACCCAAAAACACYAGCCAA+ 48
        G495G495-519ACAGGGAACGAAGTTGAACACTTCA 48
  • a Nucleotide positions are given according to the gene positions in HRSV-A strain A2 (GenBank accession number M11486 ) and HRSV-B strain B1 (accession number AF013254 ).